Mrgprb2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mrgprb2^em1(IMPC)Tcp
• Name: MAS-related GPR, member B2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156568
• Gene: Mrgprb2 Location: Chr7:48200713-48207834 bp, - strand Genetic Position: Chr7, 31.11 cM
• Alliance: Mrgprb2^em1(IMPC)Tcp page
• IMPC: Mrgprb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0501 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGGTGCTTAGATTCTTGATT and CATTTAGTCCCATCCCAACC targeting the 5' side and TTAGGCACCGAAGGTTCAGG and GAGTCTTCCGCCTGAACCTT targeting the 3' side of exon ENSMUSE00000388025 (exon 2). This resulted in an 890-bp deletion of Chr7 from 48552076 to 48552965 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mrgprb2 Mutation: 34 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 5 reference(s)