Tmem74^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem74^em1(IMPC)Tcp
• Name: transmembrane protein 74; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156573
• Gene: Tmem74 Location: Chr15:43728042-43733432 bp, - strand Genetic Position: Chr15, 16.82 cM
• Alliance: Tmem74^em1(IMPC)Tcp page
• IMPC: Tmem74 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0740 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with three guide RNAs containing spacer sequences of AGTGGACCCATGCAATGCTT and CAAACAAGCTTCTCCCTATC targeting the 5' side and TCTGGAACTGTCCTTGGTAG targeting the 3' side of exon ENSMUSE00000452230 resulting in a 909-bp deletion of Chr15 from 43866755 to 43867663 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem74 Mutation: 29 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)