Zfp629^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp629^em1(IMPC)Tcp
• Name: zinc finger protein 629; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156578
• Gene: Zfp629 Location: Chr7:127206203-127214969 bp, - strand Genetic Position: Chr7, 69.62 cM
• Alliance: Zfp629^em1(IMPC)Tcp page
• IMPC: Zfp629 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1036 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATAGGGGTCTGGTGATCTA and GAGGGTTCCCCACTGCCAAT targeting the 5' side and CGTGTCAGGACATCCACCAC and GCGGAACTTGCTCATGGAAC targeting the 3' side of a critical region. This resulted in a 3716-bp deletion from Chr7:127608671 to 127612386; (predicted effect on protein p.P84X.) (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp629 Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)