Tenm4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tenm4^em1(IMPC)Tcp
• Name: teneurin transmembrane protein 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156580
• Gene: Tenm4 Location: Chr7:95820453-96560300 bp, + strand Genetic Position: Chr7, 52.53 cM
• Alliance: Tenm4^em1(IMPC)Tcp page
• IMPC: Tenm4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0854 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs with spacer sequences of AAGTCTATGTTCAGTGGGGT and TGGTCAGTGGGCTACTGGCT targeting the 5' side and AATGGACCATAGTGTCCAGC and GGTATGAAGTACCTGGCCTC targeting the 3' side of a critical exon. This resulted in a 452-bp deletion Chr7:96694733 to 96695184 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

9 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tenm4 Mutation: 302 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)