Serac1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serac1^em1(IMPC)Tcp
• Name: serine active site containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156583
• Gene: Serac1 Location: Chr17:6092471-6130016 bp, - strand Genetic Position: Chr17, 3.67 cM
• Alliance: Serac1^em1(IMPC)Tcp page
• IMPC: Serac1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0929 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAGGATCTAAATATGACCC targeting the 5' side and GCTACATCAAGTTTAGAAGT targeting the 3' side of a critical region. This resulted in a 218-bp deletion from Chr17:6070720 to 6070937 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Serac1 Mutation: 41 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)