Prdm13^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prdm13^em1(IMPC)Tcp
• Name: PR domain containing 13; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156585
• Gene: Prdm13 Location: Chr4:21677480-21685963 bp, - strand Genetic Position: Chr4, 8.78 cM
• Alliance: Prdm13^em1(IMPC)Tcp page
• IMPC: Prdm13 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0446 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CTGAGCAGCTACTAGAGGCT and TGAGCCTGGCTGTGGCACAT targeting the 5' side and TCTTGCTCACCCTCGCTGTT and GCCTAGAGCTCATAAGCGAA targeting the 3' side of exons ENSMUSE00001302781 (exon 2) and ENSMUSE00001204778 (exon 3). This resulted in a 854 bp deletion of Chr4 from 21683245 to 21684098. (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prdm13 Mutation: 46 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)