Serpinb3d^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpinb3d^em1(IMPC)Tcp
• Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156590
• Gene: Serpinb3d Location: Chr1:107005893-107011210 bp, - strand Genetic Position: Chr1, 50.34 cM
• Alliance: Serpinb3d^em1(IMPC)Tcp page
• IMPC: Serpinb3d gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTGTGTAAGGTTGTCACTGA and ATCATGCAGATTTTTCACTC targeting the 5' side and CCTGTAGTATTTCCACTGAT and TATAGCCTATCTAGTGGTGT targeting the 3' side of exon ENSMUSE00001035727 (exon 4). This resulted in a 9-bp deletion of Chr1 from 107080984 to 107080992, and a 388-bp deletion of Chr1 from 107080541 to 107080928 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Serpinb3d Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)