Shisa6^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shisa6^em1(IMPC)Tcp
• Name: shisa family member 6; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156591
• Gene: Shisa6 Location: Chr11:66102551-66416790 bp, - strand Genetic Position: Chr11, 40.55 cM
• Alliance: Shisa6^em1(IMPC)Tcp page
• IMPC: Shisa6 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1026 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAAGAGGTTACTATCAATC and GGGTGCTTTGGGGGCATATA targeting the 5' side and GCAGTGGTGGATATCCTGAT and GACCTTGTCCGTCCCAGAGC targeting the 3' side of a critical region. This resulted in a 719-bp del Chr11:66502466 to 66503184 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Shisa6 Mutation: 15 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)