Col9a3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col9a3^em1(IMPC)Tcp
• Name: collagen, type IX, alpha 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156598
• Gene: Col9a3 Location: Chr2:180239895-180263985 bp, + strand Genetic Position: Chr2, 103.14 cM
• Alliance: Col9a3^em1(IMPC)Tcp page
• IMPC: Col9a3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0893 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCTTCCCTGAGGTCCCTTT, GCAGGACCCAAAGGTGCCCC, and ATGGTACTTACCCCAAGTCC. This resulted in a 2160-bp deletion on Chr2 from 180600526 to 180602685 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Col9a3 Mutation: 35 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)