Otc^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Otc^em1(IMPC)Tcp
• Name: ornithine transcarbamylase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156601
• Gene: Otc Location: ChrX:10118584-10187275 bp, + strand Genetic Position: ChrX, 4.66 cM, cytoband A1
• Alliance: Otc^em1(IMPC)Tcp page
• IMPC: Otc gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR922 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAGAGACATGCTGCACTATG and AATGCTGTGGGGTAGTCCAT targeting the 5' side and AAGCAATTACCTTGCCTGTG targeting the 3' side of a critical region. This resulted in a 258-bp del ChrX:10264681 to 10264938 and 5-bp indel ChrX:10264981 to 10264985_delCCTTT_ins AA resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Otc Mutation: 21 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)