Pah^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pah^em1(IMPC)Tcp
• Name: phenylalanine hydroxylase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156602
• Gene: Pah Location: Chr10:87357657-87419998 bp, + strand Genetic Position: Chr10, 43.64 cM, cytoband C2-D1
• Alliance: Pah^em1(IMPC)Tcp page
• IMPC: Pah gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR829 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACTATGCTTGAAGTCCGTGC and TGGGCTGCCCACTAGAATAC targeting the 5' side and TGGGCTGCCCACTAGAATAC and TCACACCTAACATTCTTGCA targeting the 3' side of a critical region. This resulted in a 317-bp deletion Chr10:87567166 to 87567482 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pah Mutation: 50 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)