Prl7d1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prl7d1^em1(IMPC)Tcp
• Name: prolactin family 7, subfamily d, member 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156603
• Gene: Prl7d1 Location: Chr13:27892981-27900720 bp, - strand Genetic Position: Chr13, 12.6 cM
• Alliance: Prl7d1^em1(IMPC)Tcp page
• IMPC: Prl7d1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0724 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CAACTACGTACTTGAGAAGT and TATAGTGCCAGATCATACAG targeting the 5' side and TTGGATCTTGCTGTGTTCTC and CTCTATAAGCACCTCGGAAA targeting the 3' side of exons ENSMUSE00000289168 and ENSMUSE00000117231. This resulted in a 1667-bp deletion of Chr13 from 27712921 to 27714587 and a 3-bp deletion of Chr13 from 27714679 to 27714677. (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prl7d1 Mutation: 31 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)