About   Help   FAQ
Ighmbp2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ighmbp2em1(IMPC)Tcp
Name: immunoglobulin mu DNA binding protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156604
Gene: Ighmbp2  Location: Chr19:3309076-3333011 bp, - strand  Genetic Position: Chr19, 3.03 cM
Alliance: Ighmbp2em1(IMPC)Tcp page
IMPC: Ighmbp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0651 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AACTGCCACAAGTTGCCTTC and CACATACCGTAATAACTAGC targeting the 5' side and GGAAACTGCAGAGTACGGT and ACAAAGGCCGAGCTATCTTC targeting the 3' side of a critical region. This resulted in a 3,481-bp deletion of Chr19 from 3276537 to 3280017 with insertion of insTTTC. (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ighmbp2 Mutation:  46 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory