Dnajc13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnajc13^em1(IMPC)J
• Name: DnaJ heat shock protein family (Hsp40) member C13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6157328
• Synonyms: Dnajc13^-
• Gene: Dnajc13 Location: Chr9:104028481-104140129 bp, - strand Genetic Position: Chr9, 56.61 cM
• Alliance: Dnajc13^em1(IMPC)J page
• IMPC: Dnajc13 gene page

Dnajc13^em1(IMPC)J/Dnajc13^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCTTTCTAGACTCTCGA, GTTCCCACTAAAATAAGTGG, CTGACTTCAGCAGGGAAGAT and ATAGTTCCCACTAAAATAAG, which resulted in a 495 bp deletion beginning at Chromosome 9 position 104,238,263 bp and ending after 104,238,757 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000395222 (exon 3) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dnajc13 Mutation: 83 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)