Prss56^em2(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prss56^em2(IMPC)J
• Name: serine protease 56; endonuclease-mediated mutation 2, Jackson
• MGI ID: MGI:6157340
• Gene: Prss56 Location: Chr1:87111035-87116127 bp, + strand Genetic Position: Chr1, 44.07 cM, cytoband C5
• Alliance: Prss56^em2(IMPC)J page
• IMPC: Prss56 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTAGGTTCCATCGTCCTTG, TTTGAAGGTCCAAGTGGAAG, GCAGGGCCACCCAATCCGAT and GTGTGGCTGTTGTGACCCAA, which resulted in a 845 bp deletion beginning at Chromosome 1 position 87,184,358 bp and ending after 87,185,202 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000985401 and ENSMUSE00001040282 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prss56 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)