Cdc23^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc23^em1(IMPC)J
• Name: CDC23 cell division cycle 23; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6157342
• Gene: Cdc23 Location: Chr18:34764004-34784788 bp, - strand Genetic Position: Chr18, 18.69 cM
• Alliance: Cdc23^em1(IMPC)J page
• IMPC: Cdc23 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCATCCATCTCTACCCGA, TTATTAATAAAACCAGCAGC, AAGCAAGCATGATTCAAGCG and AGGCGGATGTTGTTTTGCTT, which resulted in a 270 bp deletion beginning at Chromosome 18 position 34,644,966 bp and ending after 34,645,235 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208921 (exon 4) and 227 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 7 bp insertion (GTCTATA) at the deletion site that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 124 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdc23 Mutation: 57 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)