About   Help   FAQ
Cdc23em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdc23em1(IMPC)J
Name: CDC23 cell division cycle 23; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6157342
Gene: Cdc23  Location: Chr18:34764004-34784788 bp, - strand  Genetic Position: Chr18, 18.69 cM
Alliance: Cdc23em1(IMPC)J page
IMPC: Cdc23 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCATCCATCTCTACCCGA, TTATTAATAAAACCAGCAGC, AAGCAAGCATGATTCAAGCG and AGGCGGATGTTGTTTTGCTT, which resulted in a 270 bp deletion beginning at Chromosome 18 position 34,644,966 bp and ending after 34,645,235 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208921 (exon 4) and 227 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 7 bp insertion (GTCTATA) at the deletion site that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 124 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdc23 Mutation:  57 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory