About   Help   FAQ
Pgm1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pgm1em1(IMPC)J
Name: phosphoglucomutase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6157346
Gene: Pgm1  Location: Chr4:99786648-99844491 bp, + strand  Genetic Position: Chr4, 45.71 cM
Alliance: Pgm1em1(IMPC)J page
IMPC: Pgm1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCCACGAAGAAATGCCA, CTGATTCCCATCTTAAGAAG, TGTGACAGTCCATCTGGGGA and GCTACAATTCATTACAAAGA, which resulted in a 521 bp deletion beginning at Chromosome 4 position 99,961,333 bp and ending after 99,961,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001083174 (exon 2) and 358 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 26 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pgm1 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory