About   Help   FAQ
Tedc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tedc2em1(IMPC)J
Name: tubulin epsilon and delta complex 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6157624
Gene: Tedc2  Location: Chr17:24434028-24439825 bp, - strand  Genetic Position: Chr17, 12.32 cM, cytoband A3.3
Alliance: Tedc2em1(IMPC)J page
IMPC: Tedc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intergenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCATGGCTCAGAACCCAT, CTATCCTTACCCCTTATCCA, AGTGCATGACCCTTACGGGT and AGAATGTTTGGACCATACCA, which resulted in a 920 bp deletion beginning at Chromosome 17 position 24,219,468 bp and ending after 24,220,387 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001233864 and ENSMUSE00001227889 (exons 3 and 4) and 458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50, a deletion of 154 amino acids and then remain in frame until normal termination. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tedc2 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory