Tedc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tedc2^em1(IMPC)J
• Name: tubulin epsilon and delta complex 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6157624
• Gene: Tedc2 Location: Chr17:24434028-24439825 bp, - strand Genetic Position: Chr17, 12.32 cM, cytoband A3.3
• Alliance: Tedc2^em1(IMPC)J page
• IMPC: Tedc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCATGGCTCAGAACCCAT, CTATCCTTACCCCTTATCCA, AGTGCATGACCCTTACGGGT and AGAATGTTTGGACCATACCA, which resulted in a 920 bp deletion beginning at Chromosome 17 position 24,219,468 bp and ending after 24,220,387 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001233864 and ENSMUSE00001227889 (exons 3 and 4) and 458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50, a deletion of 154 amino acids and then remain in frame until normal termination. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tedc2 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)