Tedc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tedc2em1(IMPC)J |
Name: |
tubulin epsilon and delta complex 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6157624 |
Gene: |
Tedc2 Location: Chr17:24434028-24439825 bp, - strand Genetic Position: Chr17, 12.32 cM, cytoband A3.3
|
Alliance: |
Tedc2em1(IMPC)J page
|
IMPC: |
Tedc2 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intergenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCATGGCTCAGAACCCAT, CTATCCTTACCCCTTATCCA, AGTGCATGACCCTTACGGGT and AGAATGTTTGGACCATACCA, which resulted in a 920 bp deletion beginning at Chromosome 17 position 24,219,468 bp and ending after 24,220,387 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001233864 and ENSMUSE00001227889 (exons 3 and 4) and 458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50, a deletion of 154 amino acids and then remain in frame until normal termination.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|