About   Help   FAQ
Gpr39em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr39em1(IMPC)Mbp
Name: G protein-coupled receptor 39; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6158475
Gene: Gpr39  Location: Chr1:125604732-125801599 bp, + strand  Genetic Position: Chr1, 54.7 cM, cytoband E3
Alliance: Gpr39em1(IMPC)Mbp page
IMPC: Gpr39 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 RNA and the guide sequence CCCGTGTCATCGATCACAGCCAT, which resulted in a Indel. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gpr39 Mutation:  28 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory