Gpr39^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr39^em1(IMPC)Mbp
• Name: G protein-coupled receptor 39; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158475
• Gene: Gpr39 Location: Chr1:125604732-125801599 bp, + strand Genetic Position: Chr1, 54.7 cM, cytoband E3
• Alliance: Gpr39^em1(IMPC)Mbp page
• IMPC: Gpr39 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and the guide sequence CCCGTGTCATCGATCACAGCCAT, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gpr39 Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)