Gabpa^em2(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gabpa^em2(IMPC)Mbp
• Name: GA repeat binding protein, alpha; endonuclease-mediated mutation 2, Mouse Biology Program, UC Davis
• MGI ID: MGI:6158477
• Gene: Gabpa Location: Chr16:84631813-84660667 bp, + strand Genetic Position: Chr16, 46.92 cM, cytoband C3-4
• Alliance: Gabpa^em2(IMPC)Mbp page
• IMPC: Gabpa gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and the guide sequence CTGATAGAAATTGAGATCGACGG, which resulted in a Indel. (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gabpa Mutation: 67 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)