Palmd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Palmd^em1(IMPC)J
• Name: palmdelphin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6158662
• Gene: Palmd Location: Chr3:116711907-116762636 bp, - strand Genetic Position: Chr3, 50.49 cM
• Alliance: Palmd^em1(IMPC)J page
• IMPC: Palmd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACCGAGCTCCTTCCCTAAAA and AGTCTTATGCATGGCGACAG, which resulted in a 266 bp deletion beginning at Chromosome 3 position 116,947,864 bp and ending after 116,948,129 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323056 (exon 3) and 141 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (GT) 11 bp after the 266 bp deletion that will not alter the results of the 266 bp deletion. The 266 bp deletion is predicted to cause a change of amino acid sequence after residue 42 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Palmd Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)