Rnf40^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf40^em1(IMPC)J
• Name: ring finger protein 40; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6158667
• Gene: Rnf40 Location: Chr7:127187936-127202777 bp, + strand Genetic Position: Chr7, 69.61 cM
• Alliance: Rnf40^em1(IMPC)J page
• IMPC: Rnf40 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACTCAGACACATCACAC, CTGAGAACATAAGCTCCCCA, GGACAAGGATTAGACTGAAA and TGTGGGGCTACCGAAATGCC, which resulted in a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000203766 and ENSMUSE00000203748 (exons 3 and 4) and 283 bp of flanking intronic sequence including the splice acceptor and donor. There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 44 and early truncation 85 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnf40 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)