About   Help   FAQ
Fbxo21em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fbxo21em1(IMPC)J
Name: F-box protein 21; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6159262
Gene: Fbxo21  Location: Chr5:118114835-118148263 bp, + strand  Genetic Position: Chr5, 57.73 cM
Alliance: Fbxo21em1(IMPC)J page
IMPC: Fbxo21 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Fbxo21-113150J-9663M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCAGGTCTGAATGTGCCG, TTTGTGTACACCTACTCCCG, GCCTCAACCATGAGTTAGCG and CTTCACCAGGATAACTGCAG, which resulted in a 305 bp deletion beginning at Chromosome 5 position 117,979,701 bp and ending after 117,980,005 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000291184 (exon 3) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single base (G) insertion at the deletion site that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fbxo21 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory