Taok3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taok3^em1(IMPC)J
• Name: TAO kinase 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6159644
• Gene: Taok3 Location: Chr5:117258194-117413284 bp, + strand Genetic Position: Chr5, 56.88 cM
• Alliance: Taok3^em1(IMPC)J page
• IMPC: Taok3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTTGGTGTGGTTAACTTG, AGTGTCCGTGCCTGTACATG, which resulted in a 279 bp deletion followed by a 3 bp (GTG) endogenous retention and an additional 42 bp deletion beginning at Chromosome 5 position 117,203,195 bp and ending after 117,203,518 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280462 (exon 6) and 275 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 29 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Taok3 Mutation: 51 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)