About   Help   FAQ
Ints3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ints3em1(IMPC)J
Name: integrator complex subunit 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6161377
Gene: Ints3  Location: Chr3:90298691-90340800 bp, - strand  Genetic Position: Chr3, 39.22 cM
Alliance: Ints3em1(IMPC)J page
IMPC: Ints3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GAGGGAAATGAGCTCAGCAG, AATCTCTTCAGTCATCCCGA, GTTCTCCATCTGCCACCATC and TTACATCCTAAAAGAGAGAA, which resulted in a 460 bp deletion beginning at Chromosome 3 position 90,413,231 bp and ending after 90,413,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000457114 (exon 6) and 393 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp deletion (AG) 50 bp before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 172 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ints3 Mutation:  68 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory