Safb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Safb2^em1(IMPC)J
• Name: scaffold attachment factor B2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6161399
• Gene: Safb2 Location: Chr17:56867965-56891585 bp, - strand Genetic Position: Chr17, 29.39 cM
• Alliance: Safb2^em1(IMPC)J page
• IMPC: Safb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCCCAGCGTCAAGCAC and GTTGCAGAGTCACTGTCAGC, which resulted in a 317 bp deletion beginning at Chromosome 17 position 56,582,960 bp and ending after 56,583,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220258 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 25 amino acids later. (J:188991)
• Inheritance: Not Specified

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
hm1	Safb2^em1(IMPC)J/Safb2^em1(IMPC)J	C57BL/6NJ-Safb2^em1(IMPC)J/Mmjax

Phenotypes:

Affected Systems	hm1
show or hide all annotated terms Sex:
Source:	IMPC - JAX	IMPC - JAX
adipose tissue		√
decreased total body fat amount		√
behavior/neurological	√	√
hyperactivity	√	√
increased vertical activity	√
abnormal vocalization	√	√
integument	√	√
abnormal coat/hair pigmentation	√	√
mortality/aging	√	√
preweaning lethality, incomplete penetrance	√	√
pigmentation	√	√
abnormal coat/hair pigmentation	√	√
skeleton	√	√
abnormal bone structure	√	√
increased bone mineral content	√	√

View phenotypes and curated references for all genotypes (concatenated display).

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Safb2 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)