About   Help   FAQ
Lrrc41em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lrrc41em1(IMPC)J
Name: leucine rich repeat containing 41; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6161420
Gene: Lrrc41  Location: Chr4:115932466-115954240 bp, + strand  Genetic Position: Chr4, 53.1 cM
Alliance: Lrrc41em1(IMPC)J page
IMPC: Lrrc41 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGGTATCACTTGTCAGACAA, CTATTGGAGGAAAGGCCAAG, AAGGTATCACTTGTCAGACA and GCACTGTGCCTAATCAAGAG, which resulted in a 1426 bp deletion beginning at Chromosome 4 position 116,088,205 bp and ending after 116,089,630 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000181518 (exon 4) and 303 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is an 11bp deletion (CTTGGCCTTTC) 128 bp before the exon deletion, and a 16 bp insertion (AAACCTAGATTTGTGC) at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 40 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lrrc41 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory