About   Help   FAQ
Trank1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trank1em1(IMPC)J
Name: tetratricopeptide repeat and ankyrin repeat containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6161422
Gene: Trank1  Location: Chr9:111140807-111224843 bp, + strand  Genetic Position: Chr9, 60.95 cM, cytoband F2
Alliance: Trank1em1(IMPC)J page
IMPC: Trank1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences CTTAACCCCCTAAAAGGACG, AAAGCAATCAAATCAAGAGG, ATATTTGTATTGATTGGTGT and AGAAGAGCAAGTGCGTTCAA, which resulted in a 606 bp deletion beginning at Chromosome 9 position 111,333,325 bp and ending after 111,333,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366889(exon 2) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 48 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Trank1 Mutation:  135 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory