Slc39a10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc39a10^em1(IMPC)J
• Name: solute carrier family 39 (zinc transporter), member 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6162488
• Gene: Slc39a10 Location: Chr1:46846704-46932012 bp, - strand Genetic Position: Chr1, 24.07 cM
• Alliance: Slc39a10^em1(IMPC)J page
• IMPC: Slc39a10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences GTATGAGTACTACCTTAAAG, ATTTTTTGCATAAATTCCTA, TATTTCCTCTGGCCCTGTAG and TCTGATCCTGTATGAATCTT, which resulted in a 521 bp deletion beginning at Chromosome 1 position 46,832,525 bp and ending after 46,833,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001325787 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) insertion 164 bp after the exon deletion that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 338 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc39a10 Mutation: 51 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)