Mon2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mon2^em1(IMPC)J
• Name: MON2 homolog, regulator of endosome to Golgi trafficking; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6163850
• Gene: Mon2 Location: Chr10:122827965-122912410 bp, - strand Genetic Position: Chr10, 72.15 cM
• Alliance: Mon2^em1(IMPC)J page
• IMPC: Mon2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAGATGCTCAAAAAACTGG, AGTGTTCAGGCATTCCACCG, GAACTGATTTTATTTCCCAG and GTGTTGTGTGTGCCACTACT, which resulted in a 388 bp deletion beginning at Chromosome 10 position 123,059,114 bp and ending after 123,059,501 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000419243 (exon 2) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mon2 Mutation: 86 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)