Psmd6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Psmd6^em1(IMPC)J
• Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6187994
• Gene: Psmd6 Location: Chr14:8348818-8357578 bp, + strand Genetic Position: Chr14, 7.08 cM
• Alliance: Psmd6^em1(IMPC)J page
• IMPC: Psmd6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTTGCACTGATGTACAACAT, GCTAAGATCGGCTCTCAAGC, AGCACCTCTCATCTGCAGAG and TGATCGCGACTAAGGCCAAG, which resulted in a 548 bp deletion beginning at Chromosome 14 position 14,119,831 bp and ending after 14,120,378 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120407 (exon 2) and 342 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (G) insertion at the deletion site that will not alter the results of the exon deletion and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Psmd6 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)