Stt3b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stt3b^em1(IMPC)J
• Name: STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188000
• Gene: Stt3b Location: Chr9:115071649-115139489 bp, - strand Genetic Position: Chr9, 67.71 cM, cytoband F3
• Alliance: Stt3b^em1(IMPC)J page
• IMPC: Stt3b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CATTTCCTGCTAAGGGACGA, ACAGTAGTAGCCTCTTCACA, TTGAGTTTAAAAGCTTTTGG and TTTTAACAGACAAAAGTGAA, which resulted in a 633 bp deletion beginning at Chromosome 9 position 115,280,019 bp and ending after 115,280,651 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219753 (exon 2) and 524 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Stt3b Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)