About   Help   FAQ
Psmd13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Psmd13em1(IMPC)J
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6188002
Gene: Psmd13  Location: Chr7:140462307-140478555 bp, + strand  Genetic Position: Chr7, 86.09 cM, cytoband F5
Alliance: Psmd13em1(IMPC)J page
IMPC: Psmd13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences TTTAACTCCTGGCTGTGCAG and TCAACATCGTCTGAGCTGTC, which resulted in a 208 bp deletion beginning at Chromosome 7 position 140,883,394 bp and ending after 140,883,601 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295831 (exon 2) and 129 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Psmd13 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/22/2024
MGI 6.24
The Jackson Laboratory