Kpna4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kpna4^em1(IMPC)J
• Name: karyopherin subunit alpha 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188008
• Gene: Kpna4 Location: Chr3:68979554-69034425 bp, - strand Genetic Position: Chr3, 32.18 cM, cytoband E2
• Alliance: Kpna4^em1(IMPC)J page
• IMPC: Kpna4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTGGTAGAAAATAAACTACC, AAACATTTCACATACTAGAG, GTATGTTACTTTACAAATCT and ACATTTCTAAGTCAGGATGT, which resulted in a 293 bp deletion beginning at Chromosome 3 position 69,094,589 bp and ending after 69,094,881 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000567751 (exon 7) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kpna4 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)