Utp20^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Utp20^em1(IMPC)J
• Name: UTP20 small subunit processome component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188020
• Gene: Utp20 Location: Chr10:88582469-88662666 bp, - strand Genetic Position: Chr10, 44.21 cM
• Alliance: Utp20^em1(IMPC)J page
• IMPC: Utp20 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCTGATACAGTAAACTAACA, GCAGCAGGTCTACCAGCAGC, GAGAAAGTGCAATGTACACC and GCATCTTAGGACAAGGATAA, which resulted in a 691 bp deletion beginning at Chromosome 10 position 88,821,559 bp and ending after 88,822,249 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000608557 and ENSMUSE00000608556 (exons 3 and 4) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Utp20 Mutation: 137 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)