Ralgps1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ralgps1^em1(IMPC)J
• Name: Ral GEF with PH domain and SH3 binding motif 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188291
• Gene: Ralgps1 Location: Chr2:33023429-33261498 bp, - strand Genetic Position: Chr2, 22.25 cM
• Alliance: Ralgps1^em1(IMPC)J page
• IMPC: Ralgps1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAACAGCCTTCTCCAACCA, CCCAACATAGATCTCTGTGA, GGATAGGAACACTAGTGAGG and ACTTCTATCCAGGGTTTGAT, which resulted in a 524 bp deletion beginning at Chromosome 2 position 33,260,322 bp for 139 bp then a 7 bp (GTTGTGG) endogenous retention followed by an additional 385 bp deletion ending after 33,260,852 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000603840 (exon 8) and 397 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp deletion (ACTCTC) 19 bp before the 524 bp deletion as well as a 5 bp deletion (GTGGAG) 31 bp after the 524 bp deletion, neither of which are expected to alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 161 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ralgps1 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)