About   Help   FAQ
Ralgps1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ralgps1em1(IMPC)J
Name: Ral GEF with PH domain and SH3 binding motif 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6188291
Gene: Ralgps1  Location: Chr2:33023429-33261498 bp, - strand  Genetic Position: Chr2, 22.25 cM
Alliance: Ralgps1em1(IMPC)J page
IMPC: Ralgps1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAACAGCCTTCTCCAACCA, CCCAACATAGATCTCTGTGA, GGATAGGAACACTAGTGAGG and ACTTCTATCCAGGGTTTGAT, which resulted in a 524 bp deletion beginning at Chromosome 2 position 33,260,322 bp for 139 bp then a 7 bp (GTTGTGG) endogenous retention followed by an additional 385 bp deletion ending after 33,260,852 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000603840 (exon 8) and 397 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 6 bp deletion (ACTCTC) 19 bp before the 524 bp deletion as well as a 5 bp deletion (GTGGAG) 31 bp after the 524 bp deletion, neither of which are expected to alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 161 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ralgps1 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory