Rusc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rusc2^em1(IMPC)J
• Name: RUN and SH3 domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188969
• Gene: Rusc2 Location: Chr4:43381979-43427088 bp, + strand Genetic Position: Chr4, 23.03 cM
• Alliance: Rusc2^em1(IMPC)J page
• IMPC: Rusc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAGTCCAGGAGCTACTACA, GGGATGCCTTTACCCCACCG, CGTGGGTCTTTCCTTTTCCG and CTGCCTGGAAGGAGACCGGA, which resulted in a 1006 bp deletion beginning at Chromosome 4 position 43,423,415 bp and ending after 43,424,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313395, ENSMUSE00001264890, ENSMUSE00001301458 (exons 6,7,8) and 648 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 998 and early truncation 49 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rusc2 Mutation: 77 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)