Hspd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hspd1^em1(IMPC)J
• Name: heat shock protein 1 (chaperonin); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188980
• Gene: Hspd1 Location: Chr1:55116994-55127402 bp, - strand Genetic Position: Chr1, 28.01 cM
• Alliance: Hspd1^em1(IMPC)J page
• IMPC: Hspd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTACAACGAATGTAATAAAA, GGTGGCATCTGTTAGTACCA, AAGACAACAGAATTCTTTAC and TTGAGATTCATGTTGCAGGA, which resulted in a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374725 (exon 3) and 216 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 58 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hspd1 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)