Zc3h13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc3h13^em1(IMPC)J
• Name: zinc finger CCCH type containing 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6189585
• Gene: Zc3h13 Location: Chr14:75521813-75581866 bp, + strand Genetic Position: Chr14, 39.8 cM, cytoband D2
• Alliance: Zc3h13^em1(IMPC)J page
• IMPC: Zc3h13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CCAATAATAATAACACCATA, GTCAGGTAGGGGCTCTTTAA, AGAGAGTAGTTCCTGGAATG and CACCTGGGGCTGTGTCAGGT, which resulted in a 563 bp deletion beginning at Chromosome 14 position 75,291,999 bp and ending after 75,292,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122846 (exon 3) and 453 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zc3h13 Mutation: 65 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)