Ttc7b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttc7b^em1(IMPC)J
• Name: tetratricopeptide repeat domain 7B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6189597
• Gene: Ttc7b Location: Chr12:100267029-100487085 bp, - strand Genetic Position: Chr12, 50.43 cM
• Alliance: Ttc7b^em1(IMPC)J page
• IMPC: Ttc7b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATAACACATTCAACAGAACG, CCTGAGCACCTCACGCCCCG, GTGGATACACTGATCAGGCA and TCTTGGAGTCCATAACTATG, which resulted in a 519 bp deletion beginning at Chromosome 12 position 100,499,950 bp and ending after 100,500,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411339 (exon 2) and 364 bp of flanking intronic sequence including the splice acceptor and donor. There is also a single bp insertion (A) at the deletion site that will not alter the results of the deletion. This exon deletion is predicted to cause a change of amino acid sequence after residue 40 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttc7b Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)