Zc3h7a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc3h7a^em1(IMPC)J
• Name: zinc finger CCCH type containing 7 A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6189599
• Gene: Zc3h7a Location: Chr16:10954458-10994257 bp, - strand Genetic Position: Chr16, 6.35 cM
• Alliance: Zc3h7a^em1(IMPC)J page
• IMPC: Zc3h7a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGGCCCTGTGCCCAGCCATA, GGCTGAATTATGCTGATAGA, GTACCCTTTCGGGGCATTTC and TAAAAGTTTTGTTAGTTCTA, which resulted in a 519 bp deletion beginning at Chromosome 16 position 11,162,346 bp and ending after 11,162,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000563629 (exon 3) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zc3h7a Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)