Zer1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zer1^em1(IMPC)J
• Name: zyg-11 related, cell cycle regulator; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6189603
• Gene: Zer1 Location: Chr2:29987295-30014597 bp, - strand Genetic Position: Chr2, 21.16 cM
• Alliance: Zer1^em1(IMPC)J page
• IMPC: Zer1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCTGCGGTCCCTGTGTGCCA, CTCCACCCATAGAGAAACAA, GCAAAGGCCCCCTAAGCCTG and GCTCTCACTTCTTGATGGAA, which resulted in a 1269 bp deletion beginning at Chromosome 2 position 30,108,607 bp and ending after 30,108,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001234186, ENSMUSE00001310927, ENSMUSE00000285938 (exons 6-8) and 832 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 320 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zer1 Mutation: 70 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)