Dusp23em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Dusp23em1(IMPC)J |
Name: |
dual specificity phosphatase 23; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6194214 |
Gene: |
Dusp23 Location: Chr1:172458336-172460504 bp, - strand Genetic Position: Chr1, 80.05 cM, cytoband H3
|
Alliance: |
Dusp23em1(IMPC)J page
|
IMPC: |
Dusp23 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGCCAATGCCCGGGGAG and GGAAGCACCCAGGAGAAGTT, which resulted in a 263 bp deletion beginning at Chromosome 1 position 172,632,616 bp and ending after 172,632,878 bp (GRCm38/mm10). This mutation creates an internal deletion of 263 bp in ENSMUSE00000160363 (exon 1) resulting in a frame shift that is predicted to cause a change of amino acid sequence after residue 2 and early truncation 33 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|