1600014C10Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 1600014C10Rik^em1(IMPC)J
• Name: RIKEN cDNA 1600014C10 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6194257
• Gene: 1600014C10Rik Location: Chr7:37882642-37896992 bp, + strand Genetic Position: Chr7, 25.36 cM, cytoband B1
• Alliance: 1600014C10Rik^em1(IMPC)J page
• IMPC: 1600014C10Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCCTCATTCCCCAACAA, GCACTGCCTACACAGGACTG, TCTTAGTTGGCACAGTTCTG and GACCGGGGCTCTCTGTGTGG, which resulted in a 3,339 bp deletion beginning at Chromosome 7 position 38,194,467 bp and ending after 38,197,805 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635238 and ENSMUSE00000446563 (exons 3,4) and 480 bp of flanking intronic and 3 downstream sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 43 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 1600014C10Rik Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)