About   Help   FAQ
1600014C10Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 1600014C10Rikem1(IMPC)J
Name: RIKEN cDNA 1600014C10 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6194257
Gene: 1600014C10Rik  Location: Chr7:37882642-37896992 bp, + strand  Genetic Position: Chr7, 25.36 cM, cytoband B1
Alliance: 1600014C10Rikem1(IMPC)J page
IMPC: 1600014C10Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCCTCATTCCCCAACAA, GCACTGCCTACACAGGACTG, TCTTAGTTGGCACAGTTCTG and GACCGGGGCTCTCTGTGTGG, which resulted in a 3,339 bp deletion beginning at Chromosome 7 position 38,194,467 bp and ending after 38,197,805 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635238 and ENSMUSE00000446563 (exons 3,4) and 480 bp of flanking intronic and 3 downstream sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 43 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 1600014C10Rik Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory