Tnrc6c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnrc6c^em1(IMPC)J
• Name: trinucleotide repeat containing 6C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6195001
• Gene: Tnrc6c Location: Chr11:117545115-117654265 bp, + strand Genetic Position: Chr11, 82.96 cM
• Alliance: Tnrc6c^em1(IMPC)J page
• IMPC: Tnrc6c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTATAAACCTTCATCAGTG, ACATGTGCAATTGTGTCCAA, AGCAAACTTCTAAGTATTTT and AGTAGTATCAAACTTTGCAA, which resulted in a 139 bp deletion beginning at Chromosome 11 position 117,702,396 bp and ending after 117,702,534 bp (GRCm38/mm10). This mutation deletes the last 5 bases of ENSMUSE00001287639 (exon 3) and 134 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 6 amino acids later, by read through into the intron. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tnrc6c Mutation: 148 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)