Piezo2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Piezo2^em1(IMPC)J
• Name: piezo-type mechanosensitive ion channel component 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6195008
• Gene: Piezo2 Location: Chr18:63143284-63520254 bp, - strand Genetic Position: Chr18, 35.95 cM, cytoband D3
• Alliance: Piezo2^em1(IMPC)J page
• IMPC: Piezo2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGGGGCTCATTTCAACCTAA, CCTTGACGTTGGAAAGCCAA, TTACTACACACTAGGTTATG and GCAAACGTCTCCACTCTCCT, which resulted in a 443 bp deletion beginning at Chromosome 18 position 63,030,248 bp and ending after 63,030,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304790 (exon 42) and 190 bp of flanking intronic sequence including the splice acceptor and donor. At the deletion site there is a 126 bp insertion (AGAATGGGGACGAGGAGTGTTAGGATATTAATAAAGAACACTATTAGGGAGAGGATTTGAACCTCTGGGAACAAGGTTTTAAGTCTTACGCAATTTCCTGGCTCTGCCACCCTAATAACCTTCTCT) that is from the mouse mitochondrial genome (ChrM 2666-2791). This 126 bp segment contains the coding sequence for mt-Tl1 (tRNA leucine 1). The exon deletion is predicted to cause a change of amino acid sequence after residue 2106 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Piezo2 Mutation: 123 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)