Cabp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cabp2^em1(IMPC)J
• Name: calcium binding protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6195841
• Gene: Cabp2 Location: Chr19:4131578-4137340 bp, + strand Genetic Position: Chr19, 3.79 cM, cytoband A
• Alliance: Cabp2^em1(IMPC)J page
• IMPC: Cabp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGAAGACTGTGGGAACAG, GTGCGCTGTTCCAAACGCCC, GACACAGAAAGAGGGTGCCG and TTGTTATTAAAGGGAGAGCA, which resulted in a 954 bp deletion beginning at Chromosome 19 position 4,084,827 bp and ending after 4,085,780 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145610 and ENSMUSE00000145606 (exon 2,3) and 788 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cabp2 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)