Wdr6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr6^em1(IMPC)J
• Name: WD repeat domain 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6195848
• Gene: Wdr6 Location: Chr9:108449510-108455862 bp, - strand Genetic Position: Chr9, 59.51 cM, cytoband F2
• Alliance: Wdr6^em1(IMPC)J page
• IMPC: Wdr6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAAGGTGGACCCTGAGACC and AGGCGAGGGGCCTGATTTAC, which resulted in a 2,470 bp deletion beginning at Chromosome 9 position 108,574,104 bp and ending after 108,576,573 bp (GRCm38/mm10). This mutation deletes 2,470 bp from ENSMUSE00000240681 (exon 2) and is predicted to cause a change of amino acid sequence after residue 37 and early truncation 31 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr6 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)