Rab28^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rab28^em1(IMPC)J
• Name: RAB28, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6195850
• Gene: Rab28 Location: Chr5:41782319-41865500 bp, - strand Genetic Position: Chr5, 22.58 cM, cytoband B2
• Alliance: Rab28^em1(IMPC)J page
• IMPC: Rab28 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGACTTATATAACCTCACAC and GCACTTGCAATAACCAGCAG, which resulted in a 392 bp deletion beginning at Chromosome 5 position 41,703,352 bp and ending after 41,703,743 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000964047 (exon 2) and 295 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 25 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rab28 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)