Mvd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mvd^em1(IMPC)J
• Name: mevalonate (diphospho) decarboxylase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6196088
• Gene: Mvd Location: Chr8:123160340-123170161 bp, - strand Genetic Position: Chr8, 71.05 cM
• Alliance: Mvd^em1(IMPC)J page
• IMPC: Mvd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CGGACGTAAAACCAACCCCG, TCACTGCCCAGATACAGCCG, GATGGTCAACGGGAATTAGG and TGAACCTTCCCAGAGCACAG, which resulted in a 428 bp deletion beginning at Chromosome 8 position 122,440,127 bp and ending after 122,440,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215074 (exon 2) and 357 bp of flanking intronic sequence including the splice acceptor and donor. This exon deletion is predicted to cause a change of amino acid sequence after residue 24 and early truncation 9 amino acids later. In addition, there are 2 smaller intronic deletions before the 428 bp deletion, neither of which should alter the results of the exon deletion: a 16 bp deletion (CAACCCCGTGGCTTTG) and a single bp (T) deletion that are 71 bp and 15 bp before the 428 bp deletion, respectively. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mvd Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)